[Objective]To conduct prokaryotic fusion expression and bioactivity analysis on the insecticidal protein genes(Cry1A.301 and Vip3A)of Bacillus thuringiensis(Bt),so as to provide scientific reference for the exploration of insect-resistant gene resources and the creation of maize varieties.[Method]Utilized the connecting peptides to construct the fusion genes of Cry1A.301 and Vip3A with different insecticidal mechanisms.Then,constructed their prokaryotic ex-pression vectors and induced expression in Escherichia coli.Prediction analysis on the physicochemical properties and do-mains of the fusion proteins as well as quantitative detection was conducted.Moreover,the insecticidal activities of the fu-sion proteins against Ostrinia furnacalis,Helicoverpa armigera and Spodoptera frugiperda were detected by the artificial diet mixed feeding method.[Result]The basic framework of the constructed fusion gene was 5'-Cry1A.301-Vip3A-3',with the nucleotide sequence(TCCACCTGCTCCACCTGCTCCACC)encoding the connecting peptide(8 amino acids)assembled in the middle.Through induced expression,the fusion protein Cry1A.301-Vip3A was formed.This fusion pro-tein contained 1409 amino acids,with a molecular weight of approximately 157 kD.It was a stable acidic protein and en-compassed 4 characteristic domains of the Cry1A.301 and Vip3A protein families.The fusion protein Cry1A.301-Vip3A could be successfully expressed in E.coli strain BL21(DE3),and there was no significant difference in the expression levels of Cry1A.301 and Vip3A proteins(P>0.05,the same below).After feeding the fusion protein Cry1A.301-Vip3A for 7 d,the corrected mortality rates of O.furnacalis,H.armigera and S.frugiperda reached 100.00%.The insecticidal effect of the fusion protein Cry1A.301-Vip3A on O.furnacalis was not significantly different from that of the Cry1A.301 protein,but both were significantly higher than that of the Vip3A protein(P<0.05,the same below).The insecticidal ac-tivity of the fusion protein Cry1A.301-Vip3A on H.armigera was not significantly different from those of Vip3A protein and Cry1A.301 protein.The insecticidal activity of the fusion protein Cry1A.301-Vip3A on S.frugiperda was not signifi-cantly different from that of Vip3A protein,but was significantly higher than that of Cry1A.301 protein.[Conclusion]The Cry1A.301-Vip3A fusion protein expressed in prokaryotes has a stable structure and exhibits good insecticidal activities against O.furnacalis,H.armigera and S.frugiperda.