Effect of 12 Nucleotides Natural Insertion within the Internal Ribosome Entry Site Core Region on the Replication and Cellular Tropism of Porcine Senecavirus A
[Background]Senecavirus A(SVA)is a newly emerged picornavirus causing swine idiopathic vesicular disease and epidemic transient neonatal losses.The internal ribosome entry site(IRES)located in 5'untranslated region(UTR)of SVA genome plays a critical role in virus replication.In 2017,a natural mutant SVA strain,with 12 nucleotides discontinuously inserted into the IRES core region Domain Ⅱ,was identified in China,and its replication capacity and pathogenicity changed significantly.[Objective]The aim of this study was to investigate the effects of IRES Domain Ⅱ mutations on SVA replication and cell tropism,and to lay a foundation for further understanding the pathogenesis of SVA.[Method]An IRES mutant plasmid of pHeN-1/2018-i12 based on the background of pHeN-1/2018 were constructed,and the DNA-launched infectious clone of HeN-1/2018,with 9 nucleotides in IRES region of HeN-1/2018 genome(308-317 nt,ACTCAAGCG),were gradually replaced by the 21 nucleotides in GD04/2017 genome(308-328 nt,CACGCCTGCCGATAGACGATT)through multiple site-directed mutagenesis.The recombinant virus rHeN-1/2018-i12 was rescued and then identified by viral nucleotide genome examination,indirect immunofluorescence assay and Western blot assay,which was further examined the effect of 12 nucleotides natural insertion within the IRES core region Domain Ⅱ on the replication and cellular tropism of SVA.[Result]The pHeN-1/2018-i12 was then directly transfected into PK-15 cells and the recombinant virus rHeN-1/2018-i12 caused stable cytopathic effect was harvested after twice blind passages.Furthermore,the cellular tropism and growth kinetic of rHeN-1/2018-i12 was further investigated via virus infection assays.The viral genome of the IRES mutant virus rHeN-1/2018-i12 in the fifth and tenth passage were sequenced,and results showed that the IRES mutations passed on to the progeny viruses stably,with no nucleotide mutation in viral genome at fifth passage,and no nucleotide mutation in viral 5'-UTR region at tenth passage.Moreover,the growth characteristics of low passage recombinant virus rHeN-1/2018-i12 were further investigated in porcine cell lines PK-15 and IBRS-2,and hamster cell line BHK-21.The results showed that the recombinant virus rHeN-1/2018-i12 shared similar cellular tropism and growth dynamics with parental virus rHeN-1/2018,and all the two viruses could cause obvious CPE in PK-15 cells,IBRS-2 cells and BHK-21 cells,which indicated the mutation of 12 nucleotides insertion in the IRES core region Domain Ⅱ had no significant difference in cellular tropism.Importantly,the virus-induced CPE time of rHeN-1/2018-i12 was later than that of rHeN-1/2018,and the viral titer of rHeN-1/2018-i12 was also lower than that of rHeN-1/2018 at the same time point post infection,especially at the 24 hpi,the difference of virus titer between the two viruses can be up to 10 times.[Conclusion]The IRES mutant virus rHeN-1/2018-i12 was constructed and rescued,and further confirmed the influence of IRES mutation on SVA viral biological characteristics in this study,which provided an insight of the pathogenesis of SVA,and broadened our understanding of the function of viral type Ⅳ IRES.
国家科技期刊平台
NSTL
万方数据
